mcpB [2019-08-28 09:38:50]

membrane-bound chemotaxis receptor, methyl-accepting chemotaxis protein, receptor for asparagine

Locus: BSU_31260

Isoelectric point: 5.13

Molecular weight: 71.70 kDa

Protein length: 662 aa

Gene length: 1989 bp

Function: control of chemotaxis

Product: methyl-accepting chemotaxis protein

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Lifestyles → Exponential and early post-exponential lifestyles → Motility and chemotaxis → Signal transduction in motility and chemotaxis → Membrane-bound chemoreceptors
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,210,445 → 3,212,433

The protein

Paralogous protein(s)

• McpA, TlpB, TlpA, McpC

Kinetic information

• K(D) for asparagine: 14 myM PubMed

Domains

• Cache domain (aa 153-229) (according to UniProt)
• HAMP domain (aa 304-356) (according to UniProt)
• Methyl-accepting transducer domain (aa 375-611) (according to UniProt)

Modification

• methylated at residues Gln371, Glu630, and Glu637 PubMed

Effectors of protein activity

• asparagine (binds to the part of McpB that is exposed to the exterior) PubMed

Localization

• cell membrane PubMed
• localized at the cell poles, but in the presence of high asparagine concentration there is a reversible re-localization to the sides of the cell (lateral clusters) PubMed

Expression and Regulation

Operons

• Genes: mcpB
  Description: PubMed

  Sigma factors

  • SigD: sigma factor, PubMed, in SigD regulon

  Additional information

  • in minimal medium, McpB is present with 6,200 /- 1,900 molecules per cell PubMed

Biological materials

Mutant

• BKE31260 (ΔmcpB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCACTTGCTCCTTCAG, downstream forward: _UP4_TAAAAACCGAAAAACAGCGC
• BKK31260 (ΔmcpB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTCACTTGCTCCTTCAG, downstream forward: _UP4_TAAAAACCGAAAAACAGCGC

References

Loading